SUBMIT DIGITAL ORDER FORM

1. Login in to the DNA Order Portal using this generic account. New users fill out this form to receive the account information.
2. Choose which service you are requesting. At this time the options are Low or High Throughput Sequencing.
3. Fill out the online order form and upload the order spreadsheet (linked above the Submit button) and then click Submit. If your PI is not in our system then you will first need to request to add a new PI.
4. The website takes a long time to load. Do not navigate away until the page has fully refreshed and a yellow banner appears at the top with a message that indicates that your order was successfully submitted.

PREPARE ORDER

Samples

• Submit 4.5 uL of sample per reaction in its own tube or plate well.
• Organize your order to avoid skipping tubes of striptubes and plate wells. Avoid skipping rows in the order spreadsheet.
• Recommended concentrations depend on your DNA template type and size and are available on our website.

Non-core supplied primer submission

• Low throughput sequencing orders
  • Submit 3uL of primer (4uM) for each reaction that requires a non-core-supplied primer. Include ~5% excess volume for pipette error.
  • Submit one tube per primer. Label the tube with the primer name that you entered in the primer column of the spreadsheet and yours and your PI’s first and last initials.
• High throughput orders
  • Premix 3uL of non-core-supplied primer into your DNA template.
  • Enter ‘premix’ in the primer column of the order spreadsheet. Include your primer name in the sample column to have it included in your data filenames.
  • Non-core-supplied primers must be premixed into your DNA template to receive High Throughput pricing.

Label tubes

Label tubes by the corresponding well position in the order spreadsheet, NOT your sample name.

Striptubes: Label the first tube with the corresponding well position from the order spreadsheet (1A, 2A, 3A, 4A, …, 12A). Label each tube with yours and your PI’s first and last initials.

Plates: Ensure that well 1A is clearly marked and label the plate with the corresponding plate number from the order spreadsheet. Please reach out for a longer order spreadsheet template for submissions of more than 2 plates. Label each plate with yours and your PI’s first and last initials.

Microcentrifuge tubes: Label each tube with the corresponding well position from the order spreadsheet (1A, 1B, 1C, … 1H, 2A, 2B, 2C, … 2H). Label each tube with yours and your PI’s first and last initials.

DROP OFF OR SHIP YOUR ORDER

Timeline: We must receive your order by 1pm on Mon-Thurs and 10am on Friday to return data within 1-2 business days.

Campus users: Drop off your order in the small chest freezer outside of KCBD 1230H. The freezer has a Sanger (DNA) Core sign. Use the lab tape and marker at the freezer to label your whole order with the last names of both the User and PI and the date.

Off-campus users: You must have a PO in place or pending. Label your order with user and PI last names and the date that you placed your digital order request on the DNA Order Portal. Ship your orders to Sanger DNA Core, University of Chicago, KCBD rm 1230H, 900 E 57th St, Chicago, IL, 60637. Provide our email address for tracking updates or forward the tracking information to us when you receive it.

​

Plasmid Templates

Plasmid templates can be prepared using a variety of protocols. A rapid protocol is described below, although column (Qiagen or equivalent), standard alkaline lysis, or CsCl methods are acceptable. Do not use a boiling prep method unless the samples are phenol extracted to remove the protein! Excess protein in samples causes smearing and reduces the lifetime of our capillary arrays. The cleaner the DNA, the better the sequence! Miniprep kits do not ensure cycle-sequencing grade DNA, especially if yield is low! Some suggestions:

• Be especially careful to remove salt from plasmid prep columns by washing at least 2x and up to 4x with the alcohol solution. Only 10-20 mM salt can inhibit a sequencing reaction!It is also beneficial to wash 2x or 3x with the binding solution to remove more inhibitors. It is important to remove the alcohol from the DNA before or after elution as too much can inhibit the reaction later.
• A 0.5 M NaCl wash of the cells prior to lysis can be very helpful in removing polysaccharides and media components that often copurify with the DNA and inhibit sequencing reactions. Simply resuspend the cell pellet completely by vortexing, then re-spin.
• For some samples one or more minimal isopropanol precipitations are helpful in the removal of inhibitory compounds. To a fairly dilute DNA solution (<100 ng/µl) add 0.5 volume of 7.5 M ammonium acetate or 0.1 volume of 3 M sodium acetate, mix well, then add 0.6 volumes of room temperature isopropanol (calculated using the new volume of DNA and salt), mix well and spin after 5 minutes at room temperature. Follow with a full tube 70% ethanol wash of the pellet. Please note that standard 2 volume ethanol or 1 volume isopropanol precipitation protocols precipitate more than the DNA and may not be sufficient to purify mariginal templates. This protocol will also remove residual CsCl in gradient purified DNA (it is very inhibitory–dialysis is strongly recommended).
• Do not overgrow  colicells, especially in simple LB, as the cells decline rapidly after reaching stationary phase, usually by low pH inhibition. Overgrowth can result in release of chromosomal DNA and increases in polysaccharides that co-purify with plasmids and inhibit sequencing reactions. Richer media, especially buffered ones, delay this process.
• For standard alkaline or boiling minipreps, it is important to avoid the co-precipitation of inhibitors from the cell lysate, especially when columns are not used for purification. This can be accomplished by using only the minimal amount of room temperature isopropanol for precipitation (0.60 volumes) without chilling, and not waiting to spin or spinning longer than 5 minutes to initially precipitate the DNA.
• The majority of the RNA should be removed from miniprep DNA, either by RNAse, high salt precipitation or column purification.
• Certain strains of E. coli are better for plasmid production. Recommended strains are: XL1-Blue, DH5(alpha), DH1, C600 SURE, NM294. Other strains such as JM83, JM101, NM522, NM544, TB1, TG1, BL21, MC1061, and Y1088 often yield DNA that is of low quality, and additional purification steps (such as the mimimal isopropanol precipitation describe above) will be necessary.

PCR Templates

For PCR templates, it is important that the product is purified away from the PCR reactants, especially the primers, as these can cause high background in the sequencing reaction. Generally using a column designed for PCR product purification is sufficient in most cases or enzymatic digestion of the primers and dNTPs (Exonuclease I & shrimp alkaline phosphatase: exoSAP). Gel purification is recommended when more than a single product is present, if a large amount of PCR template DNA is present, or if primer dimers are present. Primer dimers are the result of one or both primers annealing to each other to form small products (often seen as just a smear or fuzzy blob on the bottom of a gel) that can be in high molar excess over the PCR product itself. If PCR products are purified from a gel, it is important that they not be exposed to damaging amounts of UV light. Standard transilluminators use 300 nm UV at high levels which will damage DNA in the time it takes to cut out a band (10-15 sec). This damage translates to sequences that fade, often rapidly, giving limited read lengths. Please use 366 nm UV sources (the equivalent of black lights) or reduce the exposure times or intensity (ie. a glass plate between the gel and lights works well).

DNA Concentrations of Templates

Standardize your DNA concentration to 0.2 to 0.4 µg/µl for 4 to 6 kb plasmids, increase the concentration proportionally for larger plasmids, and reduce it for smaller plasmids. For PCR products, a quick method for estimating the proper/minimal concentration is the following:

Size (kb) / 10 = concentration (µg/µl).

So for a PCR product of 500 bp, the proper (minimal) concentration would be 0.5kb/10 = 0.05 µg/µl, or 50 ng/µl. More than 10x this calculated concentration will result in noisy sequences due to pull-up peaks from excessive signal intensity. It is essential that the DNA concentration be accurate! Be aware that RNA or other contaminants in a DNA sample will give artificially high concentration values if measured spectroscopically (this is a known problem with Qiagen preps). We strongly recommend visual estimation by agarose gel. An example of such an agarose gel is shown (1 µl loaded).

The quality of sequence from plasmids larger than 15 kb is not guaranteed, although often is quite good. For first time users, provide DNA at concentrations near the high end. Low DNA concentration is our most frequent cause of low quality sequence. Please provide at least 4.5 µl of template (or its equivalent dried down) to allow for repeat reactions (we use 1.5 µl/rxn).

For BAC, cosmid, or PAC templates, the DNA concentration should be approximately 1.5 µg/µl. We must be notified of these types of reactions as they require more cycling and larger reaction volumes (the comment fields in the order form is a good place for this). Extra effort is typically required to purify these larger templates for sequencing since the DNA is more concentrated.

Important: We do not have time to dilute or concentrate samples that are at improper concentrations!

Custom Primer Considerations

If custom primers are required, please provide at least 3 µl per reaction at a concentration of about 4 µM (this is equal to 4 pmol/µl, 1 pmol of a 20mer is about 6 ng). Higher concentrations of 20 µM or above may improve results for low Tm primers (see below), but may also increase background from non-specific priming). Dried primers may require vigorous and extended pipetting action for full resuspension. Please check your primer concentrations spectroscopically if there are any doubts. See below for recommendations for custom primer design.

One of the single most important factors in successful automated DNA sequencing is proper primer design. It is important that a primer has the following characteristics:

• A melting temperature (Tm) in the range of 50 C to 65 C, preferably between 55°C and 65°C (primers with Tm’s as low as 45°C can work, we do not recommend their use, and the user accepts responsibility for failed reactions using them)
• Absence of dimerization capability
• Absence of significant hairpin formation (>3 bp)
• Lack of secondary priming sites
• Low to moderate specific binding at the 3′ end (avoid high GC content to prevent mispriming)

Primers designed according to these criteria will generally be from 18 to 30 bases in length and have %GC of 40 to 60. Try to avoid using primers with Tm’s above 65-70 C, especially on high GC templates, as this can lead to secondary priming artifacts and noisy sequences. We strongly recommend the use of computer software to design primers with these characteristics. Examples of such software are: LaserGene (DNAStar), Oligo (National Biosciences, Inc.), MacVector (Kodak/IBI) and the GCG suite. In addition, there is a web site available for designing PCR primers using the Primer program. This web site will check your primer Tm. In lieu of software, the following equation can be used to roughly estimate Tm:

Tm = 59.9 + 0.41*(%GC) – 600/length

If designing a primer based on existing sequencing data, choose a priming site that is greater than 50 nucleotides away from the position where new sequence is needed. Avoid designing primers using regions of poorer quality sequence, such as areas beyond single peak resolution of a chromatogram (typically 600-700 bases). Avoid primers where alternative priming sites are present with more than 90% identity to the primary site or that match at more than seven consecutive nucleotides at the 3′ end.

Finally, be aware that no set of guidelines will always accurately predict the success of a primer. Some primers may fail for no apparent reason, and primers that appear to be poor candidates may work well.

Recommended Plasmid Protocol for High Copy Plasmids (pUC18/19, pBlueScript, etc.)

• The recommended hosts are XL1-Blue, DH5(alpha), DH1, C600 SURE or NM294.
• Inoculate fresh (1-5 days) colony into 2 ml LB-M9 or TB medium in 25 ml test tube with appropriate amount of antibiotic and grow with high aeration (250 Revs; angled tube position, loose cap!) for 12-16 hours.
• For Qiagen columns follow their protocol, being careful not to overload the column. Add extra washes of the column with the binding buffer and the ethanol solution. If the E. coli was not a recommended strain, perform a minimal isopropanol pptn as detailed above. *Please note that DNA prepared via column protocols has not been de-proteinized and should be stored frozen due to the possible residual presence of nucleases.
• For phenol purifications, perform a standard alkaline lysis protocol keeping all solutions at room temperature and avoiding any lengthy incubation procedures.
• After the last solution has been added spin in a microfuge at room temp. for 5 min, and carefully transfer supernatant (avoid the fluff) to a clean tube (by tip, do not decant). Add 1-2 ul of 20mg/ml RNAse and incubate 20 min at room temp.
• Add an equal volume of phenol to each sample and shake well for a full minute. Spin for 2 minutes at room temp. If there is a substantial interface, remove the bottom phenol layer and add fresh and repeat shaking and spin. Remove upper aqueous phase to a new tube containing an equal volume chloroform, mix well for 15 seconds and spin for 1 minute. Remove the chloroform from the bottom, add 0.6 volumes of room temp. isopropanol, mix well and spin at room temp. for 5 minutes.
• Remove supernatant carefully as the pellet will be small and translucent. Add a full 1.5 ml 70% ethanol to the tube and mix well. Spin for 2-3 min. and carefully remove the supernatant. The pellet will be opaque white. If some supernatant remained due to invisible or loose pellet, repeat the 70% wash. Dry sample in heat block at 37-45C. Dissolve in 20-50 µl water or 1/4-strength TE and check 1 µl by gel. Dilute as necessary for sequencing.

​

We supply the following standard primers (at 4 uM):

• M13 (-21) Forward for 5′ GTAAAACGACGGCCAGT 3′
• M13 Reverse 5′ CACACAGGAAACAGCTATGACCAT 3′
• M13/pUC Forward 5′ CCCAGTCACGACGTTGTAAAACG 3′
• M13/pUC Reverse 5′ AGCGGATAACAATTTCACACAGGA 3′
• T7short 5′ TAATACGACTCACTATAGGG 3′
• T7term 5′ GCTAGTTATTGCTCAGCGG 3′
• T3 5′ AATTAACCCTCACTAAAGGGA 3′
• SP6 5′ ATTTAGGTGACACTATAG 3′
• SP6Long 5′ ATTTAGGTGACACTATAGAATAC 3′
• BGHrev 5′ TAGAAGGCACAGTCGAGG 3′
• CMV Forward 5′ CGCAAATGGGCGGTAGGCGTG 3′
• polyT-G 5′ TTTTTTTTTTTTTTTTTTTTTTTTTG 3′
• polyT-C 5′ TTTTTTTTTTTTTTTTTTTTTTTTTC 3′
• polyT-A 5′ TTTTTTTTTTTTTTTTTTTTTTTTTA 3′
• polyT(ACG) 5′ TTTTTTTTTTTTTTTTTTTTTTTTTA/C/G 3′

For large templates such as BAC’s, PAC’s and cosmids which can have higher levels of impurities, we recommend the use of the SP6long primer instead of the standard SP6 primer, which has a marginally low Tm. The SP6long primer is four bases longer (so check for compatibility with your vectors) but works well for large templates when the shorter SP6 primer fails.